What you are given
- Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
- Oligo concentration (µM): 0.25
- Na+ (mM): 50
Formula: Tm = ΔH / (ΔS + R·ln(C_T/x)), salt-corrected
Molecular biology
How do you calculate the melting temperature of a primer?
Use nearest-neighbour thermodynamics, not the 4 x GC + 2 x AT rule of thumb, which is only reasonable below about 14 bases. Tm also depends on salt and on primer concentration, so a Tm without those stated is incomplete.
Worked example
Every number below is computed by the calculator, not typed in
The working
- ΔH / ΔS:
Σ NN + init + symmetry=-161.2 kcal/mol, -438.4 cal/mol/K - Tm at 1 M Na:
ΔH / (ΔS + R·ln(C_T/x))=70.85 C - Salt-corrected Tm:
Owczarzy 2004=55.21 C
Tm = 55.2 °C.
Where this usually goes wrong
- Using the 2/4 rule for a 20-mer, which can be several degrees out.
- Ignoring the salt concentration of the reaction, which shifts Tm substantially.
- Comparing a Tm from one tool with an annealing temperature calculated by another.
Try it yourself
Two problems, with the working revealed
Problem 1 Oligo melting temperature (Tm)
Work out the melting temperature.
- Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
- Oligo concentration (µM): 0.2
- Na+ (mM): 75
Show the answer and the working
Tm = 58 °C.
- ΔH / ΔS:
Σ NN + init + symmetry=-161.2 kcal/mol, -438.4 cal/mol/K - Tm at 1 M Na:
ΔH / (ΔS + R·ln(C_T/x))=70.52 C - Salt-corrected Tm:
Owczarzy 2004=58.02 C
Open this in the calculator to change the numbers.
Problem 2 Oligo melting temperature (Tm)
Work out the melting temperature.
- Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
- Oligo concentration (µM): 0.1
- Na+ (mM): 50
Show the answer and the working
Tm = 54 °C.
- ΔH / ΔS:
Σ NN + init + symmetry=-161.2 kcal/mol, -438.4 cal/mol/K - Tm at 1 M Na:
ΔH / (ΔS + R·ln(C_T/x))=69.52 C - Salt-corrected Tm:
Owczarzy 2004=54 C
Open this in the calculator to change the numbers.
Do it with your own numbers.
The Oligo melting temperature (Tm) calculator is free, shows every step, flags the hazards, and works offline once loaded. No account, no signup.
Open the calculator