Molecular biology

Oligo melting temperature (Tm): practice problems

Work out the melting temperature. Every answer here is computed by the same tested calculator the rest of the site uses, so a solution can never drift away from the maths.

How this calculation worksOpen the calculator

Problem 1 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.2
  • Na+ (mM): 40
Show the answer and the working

Tm = 53.1 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 70.52 C
  3. Salt-corrected Tm: Owczarzy 2004 = 53.09 C

Open this in the calculator to change the numbers.

Problem 2 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.15
  • Na+ (mM): 20
Show the answer and the working

Tm = 46.6 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 70.1 C
  3. Salt-corrected Tm: Owczarzy 2004 = 46.57 C

Open this in the calculator to change the numbers.

Problem 3 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.1
  • Na+ (mM): 50
Show the answer and the working

Tm = 54 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 69.52 C
  3. Salt-corrected Tm: Owczarzy 2004 = 54 C

Open this in the calculator to change the numbers.

Problem 4 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.2
  • Na+ (mM): 50
Show the answer and the working

Tm = 54.9 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 70.52 C
  3. Salt-corrected Tm: Owczarzy 2004 = 54.91 C

Open this in the calculator to change the numbers.

Problem 5 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.75
  • Na+ (mM): 50
Show the answer and the working

Tm = 56.7 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 72.46 C
  3. Salt-corrected Tm: Owczarzy 2004 = 56.68 C

Open this in the calculator to change the numbers.

Problem 6 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.2
  • Na+ (mM): 10
Show the answer and the working

Tm = 40.1 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 70.52 C
  3. Salt-corrected Tm: Owczarzy 2004 = 40.11 C

Open this in the calculator to change the numbers.

Problem 7 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.25
  • Na+ (mM): 50
Show the answer and the working

Tm = 55.2 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 70.85 C
  3. Salt-corrected Tm: Owczarzy 2004 = 55.21 C

Open this in the calculator to change the numbers.

Problem 8 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.75
  • Na+ (mM): 30
Show the answer and the working

Tm = 52.3 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 72.46 C
  3. Salt-corrected Tm: Owczarzy 2004 = 52.34 C

Open this in the calculator to change the numbers.

Problem 9 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.2
  • Na+ (mM): 30
Show the answer and the working

Tm = 50.6 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 70.52 C
  3. Salt-corrected Tm: Owczarzy 2004 = 50.62 C

Open this in the calculator to change the numbers.

Problem 10 Oligo melting temperature (Tm)

Work out the melting temperature.

  • Oligo sequence (5′→3′): ACGTACGTACGTACGTACGT
  • Oligo concentration (µM): 0.15
  • Na+ (mM): 50
Show the answer and the working

Tm = 54.5 °C.

  1. ΔH / ΔS: Σ NN + init + symmetry = -161.2 kcal/mol, -438.4 cal/mol/K
  2. Tm at 1 M Na: ΔH / (ΔS + R·ln(C_T/x)) = 70.1 C
  3. Salt-corrected Tm: Owczarzy 2004 = 54.53 C

Open this in the calculator to change the numbers.

More molecular biology practice

Same topic, different calculation

Stuck on one of them?

Open it in the calculator and it shows the same working step by step, with the units checked and the hazards flagged. Free, no account, and it keeps working offline once the page has loaded.

Open the Oligo melting temperature (Tm) calculator